International Science Index

Synthesis, Structure and Properties of NZP/NASICON Structured Materials

The purpose of this work was to synthesize and investigate phase formation, structure and thermophysical properties of the phosphates M0.5+xM'xZr2–x(PO4)3 (M – Cd, Sr, Pb; M' – Mg, Co, Mn). The compounds were synthesized by sol-gel method. The results showed formation of limited solid solutions of NZP/NASICON type. The crystal structures of triple phosphates of the compositions MMg0.5Zr1.5(PO4)3 were refined by the Rietveld method using XRD data. Heat capacity (8–660 K) of the phosphates Pb0.5+xMgxZr2-x(PO4)3 (x = 0, 0.5) was measured, and reversible polymorphic transitions were found at temperatures, close to the room temperature. The results of Rietveld structure refinement showed the polymorphism caused by disordering of lead cations in the cavities of NZP/NASICON structure. Thermal expansion (298−1073 K) of the phosphates MMg0.5Zr1.5(PO4)3 was studied by XRD method, and the compounds were found to belong to middle and low-expanding materials. Thermal diffusivity (298–573 K) of the ceramic samples of phosphates slightly decreased with temperature increasing. As was demonstrated, the studied phosphates are characterized by the better thermophysical characteristics than widespread fire-resistant materials, such as zirconia and etc.

Paper Detail
A Study of Growth Performance, Carcass Characteristic, Meat Quality and Association of Polymorphism in the ApoVLDL-II Gene with Fat Accumulation in the Female Broiler, Thai Native and Betong Chickens (KU Line)

Both Betong chicken (KU Line) and Thai Native chickens were the high quality of the meat and low carcass fat compared to broiler chickens. The objective of this study was to determine the growth performance, carcass characteristic, meat quality and association of polymorphism in the ApoVLDL-II gene with fat accumulation in the female broiler, Thai Native and Betong (KU line) chickens at 4-14 weeks. The chickens were used and reared under the same environment and management (100 chicks per breed). The results showed that body weight (BW) of broiler chickens was significantly higher than Thai Native and Betong (KU line) chickens (P < 0.01) through all the experiment. At 4-8 weeks of age, feed conversion ratio (FCR) of broiler chickens was significantly better than Thai Native and Betong (KU line) chickens (P < 0.01), then increased at week 8-14. The percentage of breast, abdominal fat and subcutaneous fat of broiler chickens was significantly greater than Thai Native and Betong (KU line) chickens (P < 0.01). However, Thai Native chickens showed the highest percentage of liver (P < 0.01) when compared to other breeds. In addition, the percentage of wing of Thai Native and Betong (KU line) chickens were significantly (P < 0.01) higher than broiler chickens. Meat quality was also determined and found that, pH of breast meat left from slaughter 45 minutes (pH45) and 24 hours (pH24) of broiler was significantly higher than Thai Native and Betong (KU line) (P < 0.01) whereas the percentage of drip loss, thawing loss, cooking loss and shear force was not significantly different between breeds. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to genotype the polymorphism in the ApoVLDL-II gene in the broiler, Thai Native and Betong (KU line) chickens. The results found that, the polymorphism in the ApoVLDL-II gene at VLDL6 loci was not associated with fat accumulation in those studied population.

Paper Detail
Genotypic and Allelic Distribution of Polymorphic Variants of Gene SLC47A1 Leu125Phe (rs77474263) and Gly64Asp (rs77630697) and Their Association to the Clinical Response to Metformin in Adult Pakistani T2DM Patients

Background: Inter-individual variation in response to metformin, which has been considered as a first line therapy for T2DM treatment is considerable. In the current study, it was aimed to investigate the impact of two genetic variants Leu125Phe (rs77474263) and Gly64Asp (rs77630697) in gene SLC47A1 on the clinical efficacy of metformin in T2DM Pakistani patients. Methods: The study included 800 T2DM patients (400 metformin responders and 400 metformin non-responders) along with 400 ethnically matched healthy individuals. The genotypes were determined by allele-specific polymerase chain reaction. In-silico analysis was done to confirm the effect of the two SNPs on the structure of genes. Association was statistically determined using SPSS software. Results: Minor allele frequency for rs77474263 and rs77630697 was 0.13 and 0.12. For SLC47A1 rs77474263 the homozygotes of one mutant allele ‘T’ (CT) of rs77474263 variant were fewer in metformin responders than metformin non-responders (29.2% vs. 35.5 %). Likewise, the efficacy was further reduced (7.2% vs. 4.0 %) in homozygotes of two copies of ‘T’ allele (TT). Remarkably, T2DM cases with two copies of allele ‘C’ (CC) had 2.11 times more probability to respond towards metformin monotherapy. For SLC47A1 rs77630697 the homozygotes of one mutant allele ‘A’ (GA) of rs77630697 variant were fewer in metformin responders than metformin non-responders (33.5% vs. 43.0 %). Likewise, the efficacy was further reduced (8.5% vs. 4.5%) in homozygotes of two copies of ‘A’ allele (AA). Remarkably, T2DM cases with two copies of allele ‘G’ (GG) had 2.41 times more probability to respond towards metformin monotherapy. In-silico analysis revealed that these two variants affect the structure and stability of their corresponding proteins. Conclusion: The present data suggest that SLC47A1 Leu125Phe (rs77474263) and Gly64Asp (rs77630697) polymorphisms were associated with the therapeutic response of metformin in T2DM patients of Pakistan.

Paper Detail
The Effect of Dopamine D2 Receptor TAQ A1 Allele on Sprinter and Endurance Athlete

Genetic structure is very important to understand the brain dopamine system which is related to athletic performance. Hopefully, there will be enough studies about athletics performance in the terms of addiction-related genetic markers in the future. In the present study, we intended to investigate the Receptor-2 Gene (DRD2) rs1800497, which is related to brain dopaminergic system. 10 sprinter and 10 endurance athletes were enrolled in the study. Real-Time Polymerase Chain Reaction method was used for genotyping. According to results, A1A1, A1A2 and A2A2 genotypes in athletes were 0 (%0), 3 (%15) and 17 (%85). A1A1 genotype was not found and A2 allele was counted as the dominating allele in our cohort. These findings show that dopaminergic mechanism effects on sport genetic may be explained by the polygenic and multifactorial view.

Paper Detail
Identification of 332G>A Polymorphism in Exon 3 of the Leptin Gene and Partially Effects on Body Size and Tail Dimension in Sanjabi Sheep

The objective of the present study was to determine the polymorphism in the leptin (332G>A) and its association with biometric traits in Sanjabi sheep. For this purpose, blood samples from 96 rams were taken, and tail length, width tail, circumference tail, body length, body width, and height were simultaneously recorded. PCR was performed using specific primer to amplify 463 bp fragment including exon 3 of leptin gene, and PCR products were digested by Cail restriction enzymes. The 332G>A (at 332th nucleotide of exon 3 leptin gene) that caused an amino acid change from Arg to Gln was detected by Cail (CAGNNNCTG) endonuclease, as the endonuclease cannot cut this region if G nucleotide is located in this position. Three genotypes including GG (463), GA (463, 360and 103 bp) and GG (360 bp and 103 bp) were identified after digestion by enzyme. The estimated frequencies of three genotypes including GG, GA, and AA for 332G>A locus were 0.68, 0.29 and 0.03 and those were 0.18 and 0.82 for A and G alleles, respectively. In the current study, chi-square test indicated that 332G>A positions did not deviate from the Hardy–Weinberg (HW) equilibrium. The most important reason to show HW equation was that samples used in this study belong to three large local herds with a traditional breeding system having random mating and without selection. Shannon index amount was calculated which represent an average genetic variation in Sanjabi rams. Also, heterozygosity estimated by Nei index indicated that genetic diversity of mutation in the leptin gene is moderate. Leptin gene polymorphism in the 332G>A had significant effect on body length (P<0.05) trait, and individuals with GA genotype had significantly the higher body length compared to other individuals. Although animals with GA genotype had higher body width, this difference was not statistically significant (P>0.05). This non-synonymous SNP resulted in different amino acid changes at codon positions111(R/Q). As leptin activity is localized, at least in part, in domains between amino acid residues 106-1406, it is speculated that the detected SNP at position 332 may affect the activity of leptin and may lead to different biological functions. Based to our results, due to significant effect of leptin gene polymorphism on body size traits, this gene may be used a candidate gene for improving these traits.

Paper Detail
The Efficiency of Cytochrome Oxidase Subunit 1 Gene (cox1) in Reconstruction of Phylogenetic Relations among Some Crustacean Species

Some Metapenaeus monoceros cox1 gene fragments were isolated, purified, sequenced, and comparatively analyzed with some other Crustacean Cox1 gene sequences (obtained from National Center for Biotechnology Information). This work was designed for testing the efficiency of this system in reconstruction of phylogenetic relations among some Crustacean species belonging to four genera (Metapenaeus, Artemia, Daphnia and Calanus). The single nucleotide polymorphism and haplotype diversity were calculated for all estimated mt-DNA fragments. The genetic distance values were 0.292, 0.015, 0.151, and 0.09 within Metapenaeus species, Calanus species, Artemia species, and Daphnia species, respectively. The reconstructed phylogenetic tree is clustered into some unique clades. Cytochrome oxidase subunit 1 gene (cox1) was a powerful system in reconstruction of phylogenetic relations among evaluated crustacean species.

Paper Detail
Influence of κ-Casein Genotype on Milk Productivity of Latvia Local Dairy Breeds

κ-casein is one of milk proteins which are very important for milk processing. Genotypes of κ-casein affect milk yield, fat, and protein content. The main factors which affect local Latvian dairy breed milk yield and composition are analyzed in research. Data were collected from 88 Latvian brown and 82 Latvian blue cows in 2015. AA genotype was 0.557 in Latvian brown and 0.232 in Latvian blue breed. BB genotype was 0.034 in Latvian brown and 0.207 in Latvian blue breed. Highest milk yield was observed in Latvian brown (5131.2 ± 172.01 kg), significantly high fat content and fat yield also was in Latvian brown (p < 0.05). Significant differences between κ-casein genotypes were not found in Latvian brown, but highest milk yield (5057 ± 130.23 kg), protein content (3.42 ± 0.03%), and protein yield (171.9 ± 4.34 kg) were with AB genotype. Significantly high fat content was observed in Latvian blue breed with BB genotype (4.29 ± 0.17%) compared with AA genotypes (3.42 ± 0.19). Similar tendency was found in protein content – 3.27 ± 0.16% with BB genotype and 2.59 ± 0.16% with AA genotype (p < 0.05). Milk yield increases by increasing parity. We did not obtain major tendency of changes of milk fat and protein content according parity.

Paper Detail
Apolipoprotein E Gene Polymorphism and Its Association with Cardiovascular Heart Disease Risk Factors in Type 2 Diabetes Mellitus

Apolipoprotein E (APOE) gene polymorphism has influence on serum lipids which relates to cardiovascular risk. The purpose of this study was to determine the frequency distribution of APOE alleles among Malaysian Type 2 Diabetes Mellitus (DM) patients with and without coronary artery disease (CAD) and their association with serum lipid profiles. A total of 115 patients were recruited in which 78 patients had Type 2 DM without CAD and 37 patients had Type 2 DM with CAD. The APOE polymorphism was detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The APOE ɛ3 allele was the most common one in both groups. There was no significant association between the APOE genotypes and the CAD status in Type 2 DM using Pearson χ2 test. Further analysis indicated there were no significant differences in all lipid parameters between E2, E3 and E4 subgroups in both groups. The study showed that the E4 allele carriers of Type 2 DM with CAD patients had higher LDL-C level and lower HDL-C level compared to the other allele carriers. However, analyses showed these levels were not statistically different. The study also showed that the Type 2 DM with CAD group with E2 allele had higher triglyceride (TG). In conclusion, further study with larger sample size is needed to confirm role of E4 as a marker of CAD among Type 2 DM patients in Malaysian population.

Paper Detail
Genetic Diversity Based Population Study of Freshwater Mud Eel (Monopterus cuchia) in Bangladesh

As genetic diversity is most important for existing, breeding and production of any fish; this study was undertaken for investigating genetic diversity of freshwater mud eel, Monopterus cuchia at population level where three ecological populations such as flooded area of Sylhet (P1), open water of Moulvibazar (P2) and open water of Sunamganj (P3) districts of Bangladesh were considered. Four arbitrary RAPD primers (OPB-12, C0-4, B-03 and OPB-08) were screened and RAPD banding patterns were analyzed among the populations considering 15 individuals of each population. In total 174, 138 and 149 bands were detected in the populations of P1, P2 and P3 respectively; however, each primer revealed less number of bands in each population. 100% polymorphic loci were recorded in P2 and P3 whereas only one monomorphic locus was observed in P1, recorded 97.5% polymorphism. Different genetic parameters such as inter-individual pairwise similarity, genetic distance, Nei genetic similarity, linkage distances, cluster analysis and allelic information, etc. were considered for measuring genetic diversity. The average inter-individual pairwise similarity was recorded 2.98, 1.47 and 1.35 in P1, P2 and P3 respectively. Considering genetic distance analysis, the highest distance 1 was recorded in P2 and P3 and the lowest genetic distance 0.444 was found in P2. The average Nei genetic similarity was observed 0.19, 0.16 and 0.13 in P1, P2 and P3, respectively; however, the average linkage distance was recorded 24.92, 17.14 and 15.28 in P1, P3 and P2 respectively. Based on linkage distance, genetic clusters were generated in three populations where 6 clades and 7 clusters were found in P1, 3 clades and 5 clusters were observed in P2 and 4 clades and 7 clusters were detected in P3. In addition, allelic information was observed where the frequency of p and q alleles were observed 0.093 and 0.907 in P1, 0.076 and 0.924 in P2, 0.074 and 0.926 in P3 respectively. The average gene diversity was observed highest in P2 (0.132) followed by P3 (0.131) and P1 (0.121) respectively.

Paper Detail
Evaluation of Antioxidant Activity as a Function of the Genetic Diversity of Canna indica Complex

Canna indica is a prominent species complex in tropical and subtropical areas. They become indigenous in Southeast Asia where they have been introduced. At present, C. indica complex comprises over hundred hybrids, are cultivated as commercial horticulture. The species complex contains starchy rhizome having economic value in terms of food and herbal medicine. In addition, bright color of the flowers makes it a valuable ornamental plant and potential source for natural colorant. This study aims to assess genetic diversity of four varieties of C. indica complex based on SRAP (sequence-related amplified polymorphism) and iPBS (inter primer binding site) markers. We also examined phytochemical characteristics and antioxidant properties of the flower extracts from four different color varieties. Results showed that despite of the genetic variation, there were no significant differences in phytochemical characteristics and antioxidant properties of flowers. The SRAP and iPBS results agree with the more primitive traits showed by morphological information and phytochemical and antioxidant characteristics from the flowers. Since Canna flowers has long been used as natural colorants together with the antioxidant activities from the ethanol extracts in this study, there are likely to be good source for cosmetics additives.

Paper Detail
Association between Single Nucleotide Polymorphism of Calpain1 Gene and Meat Tenderness Traits in Different Genotypes of Chicken: Malaysian Native and Commercial Broiler Line

Meat Tenderness is one of the most important factors affecting consumers' assessment of meat quality. Variation in meat tenderness is genetically controlled and varies among breeds, and it is also influenced by environmental factors that can affect its creation during rigor mortis and postmortem. The final postmortem meat tenderization relies on the extent of proteolysis of myofibrillar proteins caused by the endogenous activity of the proteolytic calpain system. This calpain system includes different calcium-dependent cysteine proteases, and an inhibitor, calpastatin. It is widely accepted that in farm animals including chickens, the μ-calpain gene (CAPN1) is a physiological candidate gene for meat tenderness. This study aimed to identify the association of single nucleotide polymorphism (SNP) markers in the CAPN1 gene with the tenderness of chicken breast meat from two Malaysian native and commercial broiler breed crosses. Ten, five months old native chickens and ten, 42 days commercial broilers were collected from the local market and breast muscles were removed two hours after slaughter, packed separately in plastic bags and kept at -20ºC for 24 h. The tenderness phenotype for all chickens’ breast meats was determined by Warner-Bratzler Shear Force (WBSF). Thawing and cooking losses were also measured in the same breast samples before using in WBSF determination. Polymerase chain reaction (PCR) was used to identify the previously reported C7198A and G9950A SNPs in the CAPN1 gene and assess their associations with meat tenderness in the two breeds. The broiler breast meat showed lower shear force values and lower thawing loss rates than the native chickens (p<0.05), whereas there were similar in the rates of cooking loss. The study confirms some previous results that the markers CAPN1 C7198A and G9950A were not significantly associated with the variation in meat tenderness in chickens. Therefore, further study is needed to confirm the functional molecular mechanism of these SNPs and evaluate their associations in different chicken populations.

Paper Detail
The Effect of Program Type on Mutation Testing: Comparative Study
Due to its high computational cost, mutation testing has been neglected by researchers. Recently, many cost and mutants’ reduction techniques have been developed, improved, and experimented, but few of them has relied the possibility of reducing the cost of mutation testing on the program type of the application under test. This paper is a comparative study between four operators’ selection techniques (mutants sampling, class level operators, method level operators, and all operators’ selection) based on the program code type of each application under test. It aims at finding an alternative approach to reveal the effect of code type on mutation testing score. The result of our experiment shows that the program code type can affect the mutation score and that the programs using polymorphism are best suited to be tested with mutation testing.
Paper Detail
Cognitive Weighted Polymorphism Factor: A Comprehension Augmented Complexity Metric
Polymorphism is one of the main pillars of objectoriented paradigm. It induces hidden forms of class dependencies which may impact software quality, resulting in higher cost factor for comprehending, debugging, testing, and maintaining the software. In this paper, a new cognitive complexity metric called Cognitive Weighted Polymorphism Factor (CWPF) is proposed. Apart from the software structural complexity, it includes the cognitive complexity on the basis of type. The cognitive weights are calibrated based on 27 empirical studies with 120 persons. A case study and experimentation of the new software metric shows positive results. Further, a comparative study is made and the correlation test has proved that CWPF complexity metric is a better, more comprehensive, and more realistic indicator of the software complexity than Abreu’s Polymorphism Factor (PF) complexity metric.
Paper Detail
Inventive Synthesis and Characterization of a Cesium Molybdate Compound: CsBi(MoO4)2
Cesium molybdates with general formula CsMIII(MoO4)2, where MIII = Bi, Dy, Pr, Er, exhibit rich polymorphism, and crystallize in a layered structure. These properties cause intensive studies on cesium molybdates. CsBi(MoO4)2 was synthesized by microwave method by using cerium sulphate, bismuth oxide and molybdenum (VI) oxide in an appropriate molar ratio. Characterizations were done by x-ray diffraction (XRD), fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy/energy dispersive analyze (SEM/EDS), thermo gravimetric/differantial thermal analysis (TG/DTA).
Paper Detail
The Role of MAOA Gene in the Etiology of Autism Spectrum Disorder in Males

Monoamine oxidase A gene (MAOA) is suggested to be a candidate gene implicated in many neuropsychiatric disorders, including autism spectrum disorder (ASD). This meta-analytic review evaluates the relationship between ASD and MAOA markers such as 30 bp variable number tandem repeats in the promoter region (uVNTR) and single nucleotide polymorphisms (SNPs) by using findings from recently published studies. It seems that in Caucasian males, the risk of developing ASD increase with the presence of 4- repeat allele in the promoter region of MAOA gene whereas no differences were found between autistic patients and controls in Egyptian, West Bengal and Korean population. Some studies point to the importance of specific haplotype groups of SNPs and interaction of MAOA with others genes (e. g. FOXP2 or SRY). The results of existing studies are insufficient and further research is needed.

Paper Detail
DNA Polymorphism Studies of β-Lactoglobulin Gene in Saudi Goats

Domestic goats (Capra hircus) are extremely diverse species and principal animal genetic resource of the developing world. These facilitate a persistent supply of meat, milk, fibre, and skin and are considered as important revenue generators in small pastoral environments. This study aimed to fingerprint β-LG gene at PCR-RFLP level in native Saudi goat breeds (Ardi, Habsi and Harri) in an attempt to have a preliminary image of β-LG genotypic patterns in Saudi breeds as compared to other foreign breeds such as Indian and Egyptian. Also, the Phylogenetic analysis was done to investigate evolutionary trends and similarities among the caprine β-LG gene with that of the other domestic specie, viz. cow, buffalo and sheep. Blood samples were collected from 300 animals (100 for each breed) and genomic DNA was extracted. A fragment of the β-LG gene (427bp) was amplified using specific primers. Subsequent digestion with Sac II restriction endonuclease revealed two alleles (A and B) and three different banding patterns or genotypes i.e. AA, AB and BB. The statistical analysis showed a general trend that β-LG AA genotype had higher milk yield than β-LG AB and β-LG BB genotypes. Nucleotide sequencing of the selected β-LG fragments was done and submitted to GenBank NCBI (Accession No. KJ544248, KJ588275, KJ588276, KJ783455, KJ783456 and KJ874959). Phylogenetic analysis on the basis of nucleotide sequences of native Saudi goats indicated evolutional similarity with the GenBank reference sequences of goat, Bubalus bubalis and Bos taurus. However, the origin of sheep which is the most closely related from the evolutionary point of view, was located some distance away.

Paper Detail
ACTN3 Genotype Association with Motoric Performance of Roma Children
The paper presents the results of the molecular genetics analysis in sports research, with special emphasis to use genetic information in diagnosing of motoric predispositions in Roma boys from East Slovakia. The ability and move are the basic characteristics of all living organisms. The phenotypes are influenced by a combination of genetic and environmental factors. Genetic tests differ in principle from the traditional motoric tests, because the DNA of an individual does not change during life. The aim of the presented study was to examine motion abilities and to determine the frequency of ACTN3 (R577X) gene in Roma children. Genotype data were obtained from 138 Roma and 155 Slovak boys from 7 to 15 years old. Children were investigated on physical performance level in association with their genotype. Biological material for genetic analyses comprised samples of buccal swabs. Genotypes were determined using Real Time High resolution melting PCR method (Rotor-Gene 6000 Corbett and Light Cycler 480 Roche). The software allows creating reports of any analysis, where information of the specific analysis, normalized and differential graphs and many information of the samples are shown. Roma children of analyzed group legged to non-Romany children at the same age in all the compared tests. The % distribution of R and X alleles in Roma children was different from controls. The frequency of XX genotype was 9.26%, RX 46.33% and RR was 44.41%. The frequency of XX genotype was 9.26% which is comparable to a frequency of an Indian population. Data were analyzed with the ANOVA test.
Paper Detail
ZBTB17 Gene rs10927875 Polymorphism in Slovak Patients with Dilated Cardiomyopathy

Dilated cardiomyopathy (DCM) is a severe cardiovascular disorder characterized by progressive systolic dysfunction due to cardiac chamber dilatation and inefficient myocardial contractility often leading to chronic heart failure. Recently, a genome-wide association studies (GWASs) on DCM indicate that the ZBTB17 gene rs10927875 single nucleotide polymorphism is associated with DCM. The aim of the study was to identify the distribution of ZBTB17 gene rs10927875 polymorphism in 50 Slovak patients with DCM and 80 healthy control subjects using the Custom Taqman®SNP Genotyping assays. Risk factors detected at baseline in each group included age, sex, body mass index, smoking status, diabetes and blood pressure. The mean age of patients with DCM was 52.9±6.3 years; the mean age of individuals in control group was 50.3±8.9 years. The distribution of investigated genotypes of rs10927875 polymorphism within ZBTB17 gene in the cohort of Slovak patients with DCM was as follows: CC (38.8%), CT (55.1%), TT (6.1%), in controls: CC (43.8%), CT (51.2%), TT (5.0%). The risk allele T was more common among the patients with dilated cardiomyopathy than in normal controls (33.7% versus 30.6%). The differences in genotype or allele frequencies of ZBTB17 gene rs10927875 polymorphism were not statistically significant (p=0.6908; p=0.6098). The results of this study suggest that ZBTB17 gene rs10927875 polymorphism may be a risk factor for susceptibility to DCM in Slovak patients with DCM. Studies of numerous files and additional functional investigations are needed to fully understand the roles of genetic associations.

Paper Detail
Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women

Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.

Paper Detail
RAPD Analysis of Genetic Diversity of Castor Bean

The aim of this work was to detect genetic variability among the set of 40 castor genotypes using 8 RAPD markers. Amplification of genomic DNA of 40 genotypes, using RAPD analysis, yielded in 66 fragments, with an average of 8.25 polymorphic fragments per primer. Number of amplified fragments ranged from 3 to 13, with the size of amplicons ranging from 100 to 1200 bp. Values of the polymorphic information content (PIC) value ranged from 0.556 to 0.895 with an average of 0.784 and diversity index (DI) value ranged from 0.621 to 0.896 with an average of 0.798. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared and analyzed genotypes were grouped into two main clusters and only two genotypes could not be distinguished. Knowledge on the genetic diversity of castor can be used for future breeding programs for increased oil production for industrial uses.

Paper Detail
Polymorphism of HMW-GS in Collection of Wheat Genotypes

Processes of plant breeding, testing and licensing of new varieties, patent protection in seed production, relations in trade and protection of copyright are dependent on identification, differentiation and characterization of plant genotypes. Therefore, we focused our research on utilization of wheat storage proteins as genetic markers suitable not only for differentiation of individual genotypes, but also for identification and characterization of their considerable properties. We analyzed a collection of 102 genotypes of bread wheat (Triticum aestivum L.), 41 genotypes of spelt wheat (Triticum spelta L.), and 35 genotypes of durum wheat (Triticum durum Desf.), in this study. Our results show, that genotypes of bread wheat and durum wheat were homogenous and single line, but spelt wheat genotypes were heterogenous. We observed variability of HMW-GS composition according to environmental factors and level of breeding and predict technological quality on the basis of Glu-score calculation.

Paper Detail
RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars

In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

Paper Detail
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Paper Detail
Molecular Analysis of Somaclonal Variation in Tissue Culture Derived Bananas Using MSAP and SSR Markers

The project was undertaken to determine the effects of modified tissue culture protocols e.g. age of culture and hormone levels (2,4-D) in generating somaclonal variation. Moreover, the utility of molecular markers (SSR and MSAP) in sorting off types/somaclones were investigated.

Results show that somaclonal variation is in effect due to prolonged subculture and high 2,4-D concentration. The resultant variation was observed to be due to high level of methylation events specifically cytosine methylation either at the internal or external cytosine and was identified by methylation sensitive amplification polymorphism (MSAP).Simple sequence repeats (SSR) on the other hand, was able to associate a marker to a trait of interest.

These therefore, show that molecular markers can be an important tool in sorting out variation/mutants at an early stage.

Paper Detail
TNFRSF11B Gene Polymorphisms A163G and G11811C in Prediction of Osteoporosis Risk

Osteoporosis is a complex health disease characterized by low bone mineral density, which is determined by an interaction of genetics with metabolic and environmental factors. Current research in genetics of osteoporosis is focused on identification of responsible genes and polymorphisms. TNFRSF11B gene plays a key role in bone remodeling. The aim of this study was to investigate the genotype and allele distribution of A163G (rs3102735) osteoprotegerin gene promoter and G1181C (rs2073618) osteoprotegerin first exon polymorphisms in the group of 180 unrelated postmenopausal women with diagnosed osteoporosis and 180 normal controls. Genomic DNA was isolated from peripheral blood leukocytes using standard methodology. Genotyping for presence of different polymorphisms was performed using the Custom Taqman®SNP Genotyping assays. Hardy-Weinberg equilibrium was tested for each SNP in the groups of participants using the chi-square (χ2) test. The distribution of investigated genotypes in the group of patients with osteoporosis were as follows: AA (66.7%), AG (32.2%), GG (1.1%) for A163G polymorphism; GG (19.4%), CG (44.4%), CC (36.1%) for G1181C polymorphism. The distribution of genotypes in normal controls were follows: AA (71.1%), AG (26.1%), GG (2.8%) for A163G polymorphism; GG (22.2%), CG (48.9%), CC (28.9%) for G1181C polymorphism. In A163G polymorphism the variant G allele was more common among patients with osteoporosis: 17.2% versus 15.8% in normal controls. Also, in G1181C polymorphism the phenomenon of more frequent occurrence of C allele in the group of patients with osteoporosis was observed (58.3% versus 53.3%). Genotype and allele distributions showed no significant differences (A163G: χ2=0.270, p=0.605; χ2=0.250, p=0.616; G1181C: χ2= 1.730, p=0.188; χ2=1.820, p=0.177). Our results represents an initial study, further studies of more numerous file and associations studies will be carried out. Knowing the distribution of genotypes is important for assessing the impact of these polymorphisms on various parameters associated with osteoporosis. Screening for identification of “at-risk” women likely to develop osteoporosis and initiating subsequent early intervention appears to be most effective strategy to substantially reduce the risks of osteoporosis.

Paper Detail
Identification of Single Nucleotide Polymorphism in 5'-UTR of CYP11B1 Gene in Pakistani Sahiwal Cattle

A major goal in animal genetics is to understand the role of common genetic variants in diseases susceptibility and production traits. Sahiwal cattle can be considered as a global animal genetic resource due to its relatively high milk producing ability, resistance against tropical diseases and heat tolerant. CYP11B1 gene provides instructions for making a mitochondrial enzyme called steroid 11-beta-hydroxylase. It catalyzes the 11deoxy-cortisol to cortisol and 11deoxycorticosterone to corticosterone in cattle. The bovine CYP11B1 gene is positioned on BTA14q12 comprises of eight introns and nine exons and protein is associated with mitochondrial epithelium. The present study was aimed to identify the single-nucleotide polymorphisms in CYP11B1 gene in Sahiwal cattle breed of Pakistan. Four polymorphic sites were identified in exon one of CYP11B1 gene through sequencing approach. Significant finding was the incidence of the C→T polymorphism in 5'-UTR, causing amino acid substitution from alanine to valine (A30V) in Sahiwal cattle breed. That Ala/Val polymorphism may serve as a powerful genetic tool for the development of DNA markers that can be used for the particular traits for different local cattle breeds.

Paper Detail
Analysis of Metallothionein Gene MT1A (rs11076161) and MT2A (rs10636) Polymorphisms as a Molecular Marker in Type 2 Diabetes Mellitus among Malay Population

Type 2 diabetes mellitus (T2DM) is a complex metabolic disorder that characterized by the presence of high glucose in blood that cause from insulin resistance and insufficiency due to deterioration β-cell Langerhans functions. T2DM is commonly caused by the combination of inherited genetic variations as well as our own lifestyle. Metallothionein (MT) is a known cysteine-rich protein responsible in helping zinc homeostasis which is important in insulin signaling and secretion as well as protection our body from reactive oxygen species (ROS). MT scavenged ROS and free radicals in our body happen to be one of the reasons of T2DM and its complications. The objective of this study was to investigate the association of MT1A and MT2A polymorphisms between T2DM and control subjects among Malay populations. This study involved 150 T2DM and 120 Healthy individuals of Malay ethnic with mixed genders. The genomic DNA was extracted from buccal cells and amplified for MT1A and MT2A loci; the 347bp and 238bp banding patterns were respectively produced by mean of the Polymerase Chain Reaction (PCR). The PCR products were digested with Mlucl and Tsp451 restriction enzymes respectively and producing fragments lengths of (158/189/347bp) and (103/135/238bp) respectively. The ANOVA test was conducted and it shown that there was a significant difference between diabetic and control subjects for age, BMI, WHR, SBP, FPG, HBA1C, LDL, TG, TC and family history with (P<0.05). While the HDL, CVD risk ratio and DBP does not show any significant difference with (P>0.05). The genotype frequency for AA, AG and GG of MT1A polymorphisms was 72.7%, 22.7% and 4.7% in cases and 15%, 55% and 30% in control respectively. As for MT2A, genotype frequency of GG, GC and CC was 42.7%, 27.3% and 30% in case and 5%, 40% and 55% for control respectively. Both polymorphisms show significant difference between two investigated groups with (P=0.000). The Post hoc test was conducted and shows a significant difference between the genotypes within each polymorphism (P=0. 000). The MT1A and MT2A polymorphisms were believed to be the reliable molecular markers to distinguish the T2DM subjects from healthy individuals in Malay populations.

Paper Detail
Analysis of Plasmids and Restriction Fragment Length Polymorphisms of Acinetobacter baumannii Isolated from Hospitals- AL Jouf Region- KSA
Abstract–The objectives of the current study are to determine the prevalence, etiological agents, drug susceptibility pattern and plasmid profile of Acinetobacter baumannii isolates from Hospital-Acquired Infections (HAI) at Community Hospital, Al Jouf Province, Saudi Arabia. A total of 1890 patients had developed infection during hospital admission and were included in the study. Among those who developed nosocomial infections, 15(9.4), 10(2.7) and 118 (12.7) had respiratory tract infection (RTI), blood stream infections (BSI) and urinary tract (UTI) respectively. A total of 268 bacterial isolates were isolated from nosocomial infection. S. aureus was reported in 23.5% for of the total isolates followed by Klebsiella pneumoniae (17.5%), E. coli (17.2%), P. aeruginosa (11.9%), coagulase negative staphylococcus (9%), A. baumannii (7.1%), Enterobacter spp. (3.4%), Citrobacter freundii (3%), Proteus mirabilis (2.6%), and Proteus vulgaris and Enterococcous faecalis (0.7%). Isolated organisms are multi-drug resistant, predominantly Gram-positive pathogens with a high incidence of methicillin-resistant S. aureus, extended spectrum beta lactamase and vancomycin resistant enterococci organisms. The RFLP (Fragment Length Polymorphisms) patterns of plasmid preparations from isolated A. baumannii isolates had altered RFLP patterns, possibly due to the presence of plasmid(s). Five A. baumannii isolates harbored plasmids all of which were not less than 2.71kbp in molecular weight. Hence, it showed that the gene coding for the isolates were located on the plasmid DNA while the remaining isolates which have no plasmid might showed gene coding for antibiotic resistance being located on chromosomal DNA. Nosocomial infections represent a current problem in Community Hospital, Al Jouf Province, Saudi Arabia. Problems associated with SSI include infection with multidrug resistant pathogens which are difficult to treat and are associated with increased mortality.
Paper Detail
Implication and Genetic Variations on Lipid Profile of the Fasting Respondent

PPARs function as regulators of lipid and lipoprotein metabolism. The aim of the study was to compare the lipid profile between two phases of fasting and to examine the frequency and relationship of peroxisome proliferator-activated receptor, PPARα gene polymorphisms to lipid profile in fasting respondents. We conducted a case-control study protocol, which included 21 healthy volunteers without gender discrimination at the age of 18 years old. 3 ml of blood sample was drawn before the fasting phase and during the fasting phase (in Ramadhan month). 1ml of serum for the lipid profile was analyzed by using the automated chemistry analyser (Olympus, AU 400) and the data were analysed using the Paired T-Test (SPSS ver.20). DNA was extracted and PCR was conducted utilising 6 sets of primer. Primers were designed within 6 exons of interest in PPARα gene. Genetic and metabolic characteristics of fasting respondents and controls were estimated and compared. Fasting respondents were significantly have lowered the LDL levels (p=0.03). There were no polymorphisms detected except in exon 1 with 5% of this population study respectively. The polymorphisms in exon 1 of the PPARα gene were found in low frequency. Regarding the 1375G/T and 1386G/T polymorphisms in the exon 1 of the PPARα gene, the T-allele in fasting phase had no association with the decreased LDL levels (Fisher Exact Test). However this association is more promising when the sample size is larger in order to elucidate the precise impact of the polymorphisms on lipid profile in the population. In conclusion, the PPARα gene polymorphisms do not appear to affect the LDL of fasting respondents.

Paper Detail
Variant Polymorphisms of GST and XRCC Genes and the Early Risk of Age Associated Disease in Kazakhstan

It is believed that DNA damaging toxic metabolites contributes to the development of different pathological conditions. To prevent harmful influence of toxic agents, cells developed number of protecting mechanisms, such as enzymatic reaction of detoxification of reactive metabolites and repair of DNA damage. The aim of the study was to examine the association between polymorphism of GSTT1/GSTM1 and XRCC1/3 genes and coronary artery disease (CAD) incidence. To examine a polymorphism of these genes in CAD susceptibility in patients and controls, PCR based genotyping assay was performed. For GST genes, frequency of GSTM1 null genotype among CAD affected group was significantly increased than in control group (P<0.001). Frequencies of the GSTT1 null and positive alleles are almost equal in both groups (P>0.1). We found that neither XRCC1 Arg399Gln nor XRCC3 Thr241Met were associated with CAD risk. Obtained data suggests that GSTM1 null genotype carriers are more susceptible to CAD development.

Paper Detail