International Science Index

Genotypic and Allelic Distribution of Polymorphic Variants of Gene SLC47A1 Leu125Phe (rs77474263) and Gly64Asp (rs77630697) and Their Association to the Clinical Response to Metformin in Adult Pakistani T2DM Patients

Background: Inter-individual variation in response to metformin, which has been considered as a first line therapy for T2DM treatment is considerable. In the current study, it was aimed to investigate the impact of two genetic variants Leu125Phe (rs77474263) and Gly64Asp (rs77630697) in gene SLC47A1 on the clinical efficacy of metformin in T2DM Pakistani patients. Methods: The study included 800 T2DM patients (400 metformin responders and 400 metformin non-responders) along with 400 ethnically matched healthy individuals. The genotypes were determined by allele-specific polymerase chain reaction. In-silico analysis was done to confirm the effect of the two SNPs on the structure of genes. Association was statistically determined using SPSS software. Results: Minor allele frequency for rs77474263 and rs77630697 was 0.13 and 0.12. For SLC47A1 rs77474263 the homozygotes of one mutant allele ‘T’ (CT) of rs77474263 variant were fewer in metformin responders than metformin non-responders (29.2% vs. 35.5 %). Likewise, the efficacy was further reduced (7.2% vs. 4.0 %) in homozygotes of two copies of ‘T’ allele (TT). Remarkably, T2DM cases with two copies of allele ‘C’ (CC) had 2.11 times more probability to respond towards metformin monotherapy. For SLC47A1 rs77630697 the homozygotes of one mutant allele ‘A’ (GA) of rs77630697 variant were fewer in metformin responders than metformin non-responders (33.5% vs. 43.0 %). Likewise, the efficacy was further reduced (8.5% vs. 4.5%) in homozygotes of two copies of ‘A’ allele (AA). Remarkably, T2DM cases with two copies of allele ‘G’ (GG) had 2.41 times more probability to respond towards metformin monotherapy. In-silico analysis revealed that these two variants affect the structure and stability of their corresponding proteins. Conclusion: The present data suggest that SLC47A1 Leu125Phe (rs77474263) and Gly64Asp (rs77630697) polymorphisms were associated with the therapeutic response of metformin in T2DM patients of Pakistan.

Paper Detail
CFD Simulation for Flow Behavior in Boiling Water Reactor Vessel and Upper Pool under Decommissioning Condition

In order to respond the policy decision of non-nuclear homes, Tai Power Company (TPC) will provide the decommissioning project of Kuosheng Nuclear power plant (KSNPP) to meet the regulatory requirement in near future. In this study, the computational fluid dynamics (CFD) methodology has been employed to develop a flow prediction model for boiling water reactor (BWR) with upper pool under decommissioning stage. The model can be utilized to investigate the flow behavior as the vessel combined with upper pool and continuity cooling system. At normal operating condition, different parameters are obtained for the full fluid area, including velocity, mass flow, and mixing phenomenon in the reactor pressure vessel (RPV) and upper pool. Through the efforts of the study, an integrated simulation model will be developed for flow field analysis of decommissioning KSNPP under normal operating condition. It can be expected that a basis result for future analysis application of TPC can be provide from this study.

Paper Detail
Identification of 332G>A Polymorphism in Exon 3 of the Leptin Gene and Partially Effects on Body Size and Tail Dimension in Sanjabi Sheep

The objective of the present study was to determine the polymorphism in the leptin (332G>A) and its association with biometric traits in Sanjabi sheep. For this purpose, blood samples from 96 rams were taken, and tail length, width tail, circumference tail, body length, body width, and height were simultaneously recorded. PCR was performed using specific primer to amplify 463 bp fragment including exon 3 of leptin gene, and PCR products were digested by Cail restriction enzymes. The 332G>A (at 332th nucleotide of exon 3 leptin gene) that caused an amino acid change from Arg to Gln was detected by Cail (CAGNNNCTG) endonuclease, as the endonuclease cannot cut this region if G nucleotide is located in this position. Three genotypes including GG (463), GA (463, 360and 103 bp) and GG (360 bp and 103 bp) were identified after digestion by enzyme. The estimated frequencies of three genotypes including GG, GA, and AA for 332G>A locus were 0.68, 0.29 and 0.03 and those were 0.18 and 0.82 for A and G alleles, respectively. In the current study, chi-square test indicated that 332G>A positions did not deviate from the Hardy–Weinberg (HW) equilibrium. The most important reason to show HW equation was that samples used in this study belong to three large local herds with a traditional breeding system having random mating and without selection. Shannon index amount was calculated which represent an average genetic variation in Sanjabi rams. Also, heterozygosity estimated by Nei index indicated that genetic diversity of mutation in the leptin gene is moderate. Leptin gene polymorphism in the 332G>A had significant effect on body length (P<0.05) trait, and individuals with GA genotype had significantly the higher body length compared to other individuals. Although animals with GA genotype had higher body width, this difference was not statistically significant (P>0.05). This non-synonymous SNP resulted in different amino acid changes at codon positions111(R/Q). As leptin activity is localized, at least in part, in domains between amino acid residues 106-1406, it is speculated that the detected SNP at position 332 may affect the activity of leptin and may lead to different biological functions. Based to our results, due to significant effect of leptin gene polymorphism on body size traits, this gene may be used a candidate gene for improving these traits.

Paper Detail
In vivo Therapeutic Potential of Biologically Synthesized Silver Nanoparticles
Nowadays, nanoparticles are being used in pharmacological studies for their exclusive properties such as small size, more surface area, biocompatibility and enhanced solubility. In view of this, the present study aimed to evaluate the antihyperglycemic potential of biologically synthesized silver nanoparticles (BSSNPs) and Gymnema sylvestre (GS) extract. The SEM and SEM analysis divulges that the BSSNPs were spherical in shape. EDAX spectrum exhibits peaks for the presence of silver, carbon, and oxygen atoms in the range of 1.0-3.1 keV. FT-IR reveals the binding properties of active bio-constituents responsible for capping and stabilizing BSSNPs. The results showed increased blood glucose, huge loss in body weight and downturn in plasma insulin. The GS extract (200 mg/kg, 400 mg/kg), BSSNPs (100 mg/kg, 200 mg/kg) and metformin 50 mg/kg were administered to the diabetic rats. BSSNPs at a dose level of 200 mg/kg (b.wt.p.o.) showed significant inhibition of (p<0.001) blood glucose levels as compared with GS extract treated group. The results obtained from study indicate that the BSSNP shows potent anti-diabetic activity.
Paper Detail
Association between Single Nucleotide Polymorphism of Calpain1 Gene and Meat Tenderness Traits in Different Genotypes of Chicken: Malaysian Native and Commercial Broiler Line

Meat Tenderness is one of the most important factors affecting consumers' assessment of meat quality. Variation in meat tenderness is genetically controlled and varies among breeds, and it is also influenced by environmental factors that can affect its creation during rigor mortis and postmortem. The final postmortem meat tenderization relies on the extent of proteolysis of myofibrillar proteins caused by the endogenous activity of the proteolytic calpain system. This calpain system includes different calcium-dependent cysteine proteases, and an inhibitor, calpastatin. It is widely accepted that in farm animals including chickens, the μ-calpain gene (CAPN1) is a physiological candidate gene for meat tenderness. This study aimed to identify the association of single nucleotide polymorphism (SNP) markers in the CAPN1 gene with the tenderness of chicken breast meat from two Malaysian native and commercial broiler breed crosses. Ten, five months old native chickens and ten, 42 days commercial broilers were collected from the local market and breast muscles were removed two hours after slaughter, packed separately in plastic bags and kept at -20ºC for 24 h. The tenderness phenotype for all chickens’ breast meats was determined by Warner-Bratzler Shear Force (WBSF). Thawing and cooking losses were also measured in the same breast samples before using in WBSF determination. Polymerase chain reaction (PCR) was used to identify the previously reported C7198A and G9950A SNPs in the CAPN1 gene and assess their associations with meat tenderness in the two breeds. The broiler breast meat showed lower shear force values and lower thawing loss rates than the native chickens (p<0.05), whereas there were similar in the rates of cooking loss. The study confirms some previous results that the markers CAPN1 C7198A and G9950A were not significantly associated with the variation in meat tenderness in chickens. Therefore, further study is needed to confirm the functional molecular mechanism of these SNPs and evaluate their associations in different chicken populations.

Paper Detail
Phyllantus niruri Protects against Fe2+ and SNP Induced Oxidative Damage in Mitochondrial Enriched Fractions of Rats Brain
The potential neuroprotective effect of Phyllantus nuriri against Fe2+ and sodium nitroprusside (SNP) induced oxidative stress in mitochondria of rats brain was evaluated. Cellular viability was assessed by MTT reduction, reactive oxygen species (ROS) generation was measured using the probe 2,7-dichlorofluoresce indiacetate (DCFH-DA). Glutathione content was measured using dithionitrobenzoic acid (DTNB). Fe2+ (10μM) and SNP (5μM) significantly decreased mitochondrial activity, assessed by MTT reduction assay, in a dose-dependent manner, this occurred in parallel with increased glutathione oxidation, ROS production and lipid peroxidation end-products (thiobarbituric acid reactive substances, TBARS). The co-incubation with methanolic extract of Phyllantus nuriri (10-200 μg/ml) reduced the disruption of mitochondrial activity, gluthathione oxidation, ROS production as well as the increase in TBARS levels caused by both Fe2+ and SNP in a dose dependent manner. HPLC analysis of the extract revealed the presence of gallic acid (20.540.01), caffeic acid (7.930.02), rutin (25.310.05), quercetin (31.280.03) and kaemferol (14.360.01). This result suggests that these phytochemicals account for the protective actions of P. niruri against Fe2+ and SNP -induced oxidative stress. Our results show that P. nuriri consist important bioactive molecules in the search for an improved therapy against the deleterious effects of Fe2+, an intrinsic producer of reactive oxygen species (ROS), that leads to neuronal oxidative stress and neurodegeneration.
Paper Detail
The Role of MAOA Gene in the Etiology of Autism Spectrum Disorder in Males

Monoamine oxidase A gene (MAOA) is suggested to be a candidate gene implicated in many neuropsychiatric disorders, including autism spectrum disorder (ASD). This meta-analytic review evaluates the relationship between ASD and MAOA markers such as 30 bp variable number tandem repeats in the promoter region (uVNTR) and single nucleotide polymorphisms (SNPs) by using findings from recently published studies. It seems that in Caucasian males, the risk of developing ASD increase with the presence of 4- repeat allele in the promoter region of MAOA gene whereas no differences were found between autistic patients and controls in Egyptian, West Bengal and Korean population. Some studies point to the importance of specific haplotype groups of SNPs and interaction of MAOA with others genes (e. g. FOXP2 or SRY). The results of existing studies are insufficient and further research is needed.

Paper Detail
ZBTB17 Gene rs10927875 Polymorphism in Slovak Patients with Dilated Cardiomyopathy

Dilated cardiomyopathy (DCM) is a severe cardiovascular disorder characterized by progressive systolic dysfunction due to cardiac chamber dilatation and inefficient myocardial contractility often leading to chronic heart failure. Recently, a genome-wide association studies (GWASs) on DCM indicate that the ZBTB17 gene rs10927875 single nucleotide polymorphism is associated with DCM. The aim of the study was to identify the distribution of ZBTB17 gene rs10927875 polymorphism in 50 Slovak patients with DCM and 80 healthy control subjects using the Custom Taqman®SNP Genotyping assays. Risk factors detected at baseline in each group included age, sex, body mass index, smoking status, diabetes and blood pressure. The mean age of patients with DCM was 52.9±6.3 years; the mean age of individuals in control group was 50.3±8.9 years. The distribution of investigated genotypes of rs10927875 polymorphism within ZBTB17 gene in the cohort of Slovak patients with DCM was as follows: CC (38.8%), CT (55.1%), TT (6.1%), in controls: CC (43.8%), CT (51.2%), TT (5.0%). The risk allele T was more common among the patients with dilated cardiomyopathy than in normal controls (33.7% versus 30.6%). The differences in genotype or allele frequencies of ZBTB17 gene rs10927875 polymorphism were not statistically significant (p=0.6908; p=0.6098). The results of this study suggest that ZBTB17 gene rs10927875 polymorphism may be a risk factor for susceptibility to DCM in Slovak patients with DCM. Studies of numerous files and additional functional investigations are needed to fully understand the roles of genetic associations.

Paper Detail
Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women

Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.

Paper Detail
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Paper Detail
TNFRSF11B Gene Polymorphisms A163G and G11811C in Prediction of Osteoporosis Risk

Osteoporosis is a complex health disease characterized by low bone mineral density, which is determined by an interaction of genetics with metabolic and environmental factors. Current research in genetics of osteoporosis is focused on identification of responsible genes and polymorphisms. TNFRSF11B gene plays a key role in bone remodeling. The aim of this study was to investigate the genotype and allele distribution of A163G (rs3102735) osteoprotegerin gene promoter and G1181C (rs2073618) osteoprotegerin first exon polymorphisms in the group of 180 unrelated postmenopausal women with diagnosed osteoporosis and 180 normal controls. Genomic DNA was isolated from peripheral blood leukocytes using standard methodology. Genotyping for presence of different polymorphisms was performed using the Custom Taqman®SNP Genotyping assays. Hardy-Weinberg equilibrium was tested for each SNP in the groups of participants using the chi-square (χ2) test. The distribution of investigated genotypes in the group of patients with osteoporosis were as follows: AA (66.7%), AG (32.2%), GG (1.1%) for A163G polymorphism; GG (19.4%), CG (44.4%), CC (36.1%) for G1181C polymorphism. The distribution of genotypes in normal controls were follows: AA (71.1%), AG (26.1%), GG (2.8%) for A163G polymorphism; GG (22.2%), CG (48.9%), CC (28.9%) for G1181C polymorphism. In A163G polymorphism the variant G allele was more common among patients with osteoporosis: 17.2% versus 15.8% in normal controls. Also, in G1181C polymorphism the phenomenon of more frequent occurrence of C allele in the group of patients with osteoporosis was observed (58.3% versus 53.3%). Genotype and allele distributions showed no significant differences (A163G: χ2=0.270, p=0.605; χ2=0.250, p=0.616; G1181C: χ2= 1.730, p=0.188; χ2=1.820, p=0.177). Our results represents an initial study, further studies of more numerous file and associations studies will be carried out. Knowing the distribution of genotypes is important for assessing the impact of these polymorphisms on various parameters associated with osteoporosis. Screening for identification of “at-risk” women likely to develop osteoporosis and initiating subsequent early intervention appears to be most effective strategy to substantially reduce the risks of osteoporosis.

Paper Detail
Study of the Efficacy of Cysteine Protease Inhibitors Alone or Combined with Praziquantel as Chemotherapy for Mice Schistosomiasis mansoni

This study was designed for assessment of 3 types of Cysteine protease inhibitors (CPIs) fluromethylketone (FMK), vinyl sulfone (VS) and sodium nitro prussid (SNP), to define which of them is the best for curing S. mansoni infection in mice? In vitro, treated S. mansoni adult worms recorded a mortality rate after 1 hr of exposure to 500 ppm of FMK, VS and SNP as 75, 70 and 60%, respectively. FMK+PZQ treatment recorded the maximum reduction in worm burden (97.2% at 5 wk PI). VS treatment alone or combined with PZQ increases IgM, total IgG, IgG2 and IgG4 levels. In EM study, the completely implanted spines were reported in the degenerated tegument of adult worms in all groups treated with CPIs. VS+PZQ Treatment increased Igs levels but, its effect was different on worm reduction. So, it is not enough to eliminate the infection and FMK+PZQ considered the antischistosomicidal drug of choice.

Paper Detail
A Novel Prediction Method for Tag SNP Selection using Genetic Algorithm based on KNN

Single nucleotide polymorphisms (SNPs) hold much promise as a basis for disease-gene association. However, research is limited by the cost of genotyping the tremendous number of SNPs. Therefore, it is important to identify a small subset of informative SNPs, the so-called tag SNPs. This subset consists of selected SNPs of the genotypes, and accurately represents the rest of the SNPs. Furthermore, an effective evaluation method is needed to evaluate prediction accuracy of a set of tag SNPs. In this paper, a genetic algorithm (GA) is applied to tag SNP problems, and the K-nearest neighbor (K-NN) serves as a prediction method of tag SNP selection. The experimental data used was taken from the HapMap project; it consists of genotype data rather than haplotype data. The proposed method consistently identified tag SNPs with considerably better prediction accuracy than methods from the literature. At the same time, the number of tag SNPs identified was smaller than the number of tag SNPs in the other methods. The run time of the proposed method was much shorter than the run time of the SVM/STSA method when the same accuracy was reached.

Paper Detail