In today's world, everyone has become so busy in their to-do tasks and daily routine that they tend to ignore some of the basal components of our life, including exercise and diet. This comparative study analyzes the pathways of the relationship between exercise and brain plasticity and also includes another variable diet to study the effects of diet on learning by answering questions including which diet is known to be the best learning supporter and what are the recommended quantities of the same. Further, this study looks into inter-relation between diet and exercise, and also some other approach of the relation between diet and exercise on learning apart from through Brain Derived Neurotrophic Factor (BDNF).

Electrochemical impedance spectroscopy (EIS) has been used to detect sensitization in austenitic stainless steels that are heat treated in the temperature regime 600-820 °C to produce different degrees of sensitization in the material. The tests were conducted at five different DC potentials in the transpassive region. The quantitative determination of degree of sensitization has been done using double loop electrochemical potentiokinetic reactivation tests (DL-EPR). The correlation between EIS Nyquist diagrams and DL-EPR degree of sensitization values has been studied. The EIS technique can be used as a qualitative tool in determining the intergranular corrosion in austenitic stainless steels that are heat treated at a given temperature.

Introduction: Sodium-glucose co-transporter-2 (SGLT2) inhibitors are a new class of oral anti-diabetic drugs with a unique mechanism of action. They are used to improve glycaemic control in adults with type 2 diabetes by enhancing urinary glucose excretion. In the UAE, there has been certainly an increased use of these medications. As with any new medication, there are safety considerations related to their use in patients with type two diabetes. A retrospective study was conducted at the three main centres of the Imperial College London Diabetes Centre. Methodology: All patients in electronic database (Diamond) from October 2014 to October 2017 were included with a minimum of six months usage of sodium glucose co-transporter inhibitors that comprise canagliflozin, dapagliflozin and empagliflozin. There were 15 paired sample biochemical and clinical correlations. The analysis was done at the start of the study, three months and six months apart. SPSS version 24 was used for this study. Conclusion: This study of sodium glucose co-transporter-2 inhibitors used showed significant reductions in weight, glycated haemoglobin A1C, systolic and diastolic blood pressures. As the case with systematic reviews, there were similar changes in liver enzymes, raised total cholesterol, low density lipopoptein and high density lipoprotein. There was slight improvement in estimated glomerular filtration rate too. Our analysis also showed that they increased in the incidence of urinary tract symptoms and incidence of urinary tract infections.

Over the last 40 years, there has been a trend in landscape architecture which supporters do not perceive the role of pro-ecological or postmodern solutions in the design of public green spaces as an essential goal, shifting their attention to the 'sculptural' shaping of areas with the use of slopes, hills, embankments, and other forms of terrain. This group of designers can be considered avant-garde, which in its activities refers to land art. Initial research shows that such applications are particularly frequent in places of former post-industrial sites and landfills, utilizing materials such as debris and post-mining waste in their construction. Due to the high degradation of the environment surrounding modern man, the brownfields are a challenge and a field of interest for the representatives of landscape architecture avant-garde, who through their projects try to recover lost lands by means of transformations supported by engineering and ecological knowledge to create places where nature can develop again. The analysis of a dozen or so facilities made it possible to come up with an important conclusion: apart from the cultural aspects (including artistic activities), the green areas formally referring to the land are important in the process of remediation of post-industrial sites and waste recycling (e. g. from construction sites). In these processes, there is also a potential for applying the concept of Natural Based Solutions, i.e. solutions allowing for the natural development of the site in such a way as to use it to cope with environmental problems, such as e.g.  air pollution, soil phytoremediation and climate change. The paper presents examples of modern parks, whose compositions are based on shaping the surface of the terrain in a way referring to the land art, at the same time providing an example of brownfields reuse and application of waste recycling.  For the purposes of object analysis, research methods such as historical-interpretation studies, case studies, qualitative research or the method of logical argumentation were used. The obtained results provide information about the role that landscape architecture can have in the process of remediation of degraded areas, at the same time guaranteeing the benefits, such as the shaping of landscapes attractive in terms of visual appearance, low costs of implementation, and improvement of the natural environment quality.

Universities and higher education institutes are finding it increasingly difficult to engage students fruitfully through traditional pedagogic tools. Web 2.0 technologies comprising social networking sites (SNSs) offer a platform for students to collaborate and share information, thereby enhancing their learning experience. Despite the potential and reach of SNSs, its use has been limited in academic settings promoting higher education. The purpose of this paper is to assess the perception of social networking sites among business school students in India and analyze its role in enhancing quality of student experiences in a business school leading to the proposal of an agenda for future research. In this study, more than 300 students of a reputed business school were involved in a survey of their preferences of different social networking sites and their perceptions and attitudes towards these sites. A questionnaire with three major sections was designed, validated and distributed among  a sample of students, the research method being descriptive in nature. Crucial questions were addressed to the students concerning time commitment, reasons for usage, nature of interaction on these sites, and the propensity to share information leading to direct and indirect modes of learning. It was further supplemented with focus group discussion to analyze the findings. The paper notes the resistance in the adoption of new technology by a section of business school faculty, who are staunch supporters of the classical “face-to-face” instruction. In conclusion, social networking sites like Facebook and LinkedIn provide new avenues for students to express themselves and to interact with one another. Universities could take advantage of the new ways  in which students are communicating with one another. Although interactive educational options such as Moodle exist, social networking sites are rarely used for academic purposes. Using this medium opens new ways of academically-oriented interactions where faculty could discover more about students' interests, and students, in turn, might express and develop more intellectual facets of their lives. hitherto unknown intellectual facets.  This study also throws up the enormous potential of mobile phones as a tool for “blended learning” in business schools going forward.

Foreign direct investment is a driving force in the development of the interdependent national economies, and the study and analysis of investments is an urgent problem. It is particularly important for transitional economies, such as Georgia, and the study and analysis of investments is an urgent problem. Consequently, the goal of the research is the study and analysis of direct foreign investments in Georgia, and identification and forecasting of modern trends, and covers the period of 2006-2015. The study uses the methods of statistical observation, grouping and analysis, the methods of analytical indicators of time series, trend identification and the predicted values are calculated, as well as various literary and Internet sources relevant to the research. The findings showed that modern investment policy In Georgia is favorable for domestic as well as foreign investors. Georgia is still a net importer of investments. In 2015, the top 10 investing countries was led by Azerbaijan, United Kingdom and Netherlands, and the largest share of FDIs were allocated in the transport and communication sector; the financial sector was the second, followed by the health and social work sector, and the same trend will continue in the future. 

The objective of this study was to assess the production and market of certified organic products in Thailand. A purposive sampling technique was used to identify a sample group of 154 organic entrepreneurs for the study. A survey and in-depth interview were employed for data collection. Also, secondary data from organic agriculture certification body and publications was collected. Then descriptive statistics and content analysis technique were used to describe about production and market of certified organic products in Thailand. Results showed that there were 9,218 farmers on 213,183.68 Rai (83,309.2 acre) of certified organic agriculture land (0.29% of national agriculture land). A total of 57.8% of certified organic agricultural lands were certified by the international certification body. Organic farmers produced around 71,847 tons/year and worth around THB 1,914 million (Euro 47.92 million). Excluding primary producers, 471 operators involved in the Thai organic supply chains, including processors, exporters, distributors, green shops, modern trade shops (supermarket shop), farmer’s markets and food establishments were included. Export market was the major market channel and most of organic products were exported to Europe and North America. The total Thai organic market in 2014 was estimated to be worth around THB 2,331.55 million (Euro 58.22 million), of which, 77.9% was for export and 22.06% was for the domestic market. The largest exports of certified organic products were processed foods (66.1% of total export value), followed by organic rice (30.4%). In the domestic market, modern trade was the largest sale channel, accounting for 59.48% of total domestic sales, followed by green shop (29.47%) and food establishment (5.85%). To become a center of organic farming and trading within ASEAN, the Thai organic sector needs to have more policy support in regard to agricultural chemicals, GMO, and community land title. In addition, appropriate strategies need to be developed.

The parallel usage of different media channels has increased recently owing to technological advances. Second Screen describes the use of a second device by television viewers to consume further content which is related to the program they are watching. This study analysed the characteristics of football spectators regarding their media consumption in relation to Second Screen usage while watching a football match on TV. The existing literature on Second Screen usage is still very limited, especially in the context of particular broadcasting settings such as sport or even more specific such as football matches. Therefore, the primary research objective was to reveal first insights into the user behaviour of football spectators regarding Second Screen services. The survey, which was conducted among German football supporters in 2015, revealed some characteristics such as the identification and involvement into the sports which are related to an increased use of Second Screen services. One important finding for football supporters was that at the time of a match they have a lower parallel media usage compared to other TV broadcastings. Nevertheless, if supporters used a second device while watching a match on TV, then they were using specific Second Screen services. This means they searched for more content related information. The findings on the habits and characteristics of people who are using Second Screen services are relevant for future developments in that area as well as for marketing decisions.

This research investigates cluster development in the area called the Greater Mekong Subregion (GMS), which consists of Thailand, the People’s Republic of China (PRC), the Yunnan Province and Guangxi Zhuang Autonomous Region, Myanmar, the Lao People’s Democratic Republic (Lao PDR), Cambodia, and Vietnam. The study utilized Porter’s competitiveness theory and the cluster mapping approach to analyze the competitiveness of the region. The data collection consists of interviews, focus groups, and the analysis of secondary data. The findings identify some evidence of cluster development in the GMS; however, there is no clear indication of collaboration among the components in the clusters. GMS clusters tend to be stand-alone. The clusters in Vietnam, Lao PDR, Myanmar, and Cambodia tend to be labor intensive, whereas the clusters in Thailand and the PRC (Yunnan) have the potential to successfully develop into innovative clusters. The collaboration and integration among the clusters in the GMS area are promising, though it could take a long time. The most likely relationship between the GMS countries could be, for example, suppliers of the low-end, labor-intensive products will be located in the low income countries such as Myanmar, Lao PDR, and Cambodia, and these countries will be providing input materials for innovative clusters in the middle income countries such as Thailand and the PRC.

Natural preservatives have been used as alternatives to traditional chemical preservatives; however, a limited number have been commercially developed and many remain to be investigated as sources of safer and effective antimicrobials. In this study, we have been investigating the antimicrobial activity of an extract of Glycyrrhiza glabra (liquorice) that was provided as a waste material from the production of liquorice flavourings for the food industry, and to investigate if this retained the expected antimicrobial activity so it could be used as a natural preservative. Antibacterial activity of liquorice extract was screened for evidence of growth inhibition against eight species of Gram-negative and Gram-positive bacteria, including Listeria monocytogenes, Listeria innocua, Staphylococcus aureus, Enterococcus faecalis and Bacillus subtilis. The Gram-negative bacteria tested include Pseudomonas aeruginosa, Escherichia coli and Salmonella typhimurium but none of these were affected by the extract. In contrast, for all of the Gram-positive bacteria tested, growth was inhibited as monitored using optical density. However parallel studies using viable count indicated that the cells were not killed meaning that the extract was bacteriostatic rather than bacteriocidal. The Minimum Inhibitory Concentration [MIC] and Minimum Bactericidal Concentration [MBC] of the extract was also determined and a concentration of 50 µg ml-1 was found to have a strong bacteriostatic effect on Gram-positive bacteria. Microscopic analysis indicated that there were changes in cell shape suggesting the cell wall was affected. In addition, the use of a reporter strain of Listeria transformed with the bioluminescence genes luxABCDE indicated that cell energy levels were reduced when treated with either 12.5 or 50 µg ml-1 of the extract, with the reduction in light output being proportional to the concentration of the extract used. Together these results suggest that the extract is inhibiting the growth of Gram-positive bacteria only by damaging the cell wall and/or membrane.

In this day and age, extremism in various forms of its manifestation is a real threat to the world community, the national security of a state and its territorial integrity, as well as to the constitutional rights and freedoms of citizens. Extremism, as it is known, in general terms described as a commitment to extreme views and actions, radically denying the existing social norms and rules. Supporters of extremism in the ideological and political struggles often adopt methods and means of psychological warfare, appeal not to reason and logical arguments, but to emotions and instincts of the people, to prejudices, biases, and a variety of mythological designs. They are dissatisfied with the established order and aim at increasing this dissatisfaction among the masses. Youth extremism holds a specific place among the existing forms and types of extremism. In this context in 2015, we conducted a survey among Moscow college and high school students. The aim of this study was to determine how great or small is the difference in understanding and attitudes towards extremism manifestations, inclination and readiness to take part in extremist activities and what causes this predisposition, if it exists. We performed multivariate analysis and found the Russian college and high school students' opinion about the extremism and terrorism situation in our country and also their cognition on these topics. Among other things, we showed, that the level of aggressiveness of young people were not above the average for the whole population. The survey was conducted using the questionnaire method. The sample included college and high school students in Moscow (642 and 382, respectively) by method of random selection. The questionnaire was developed by specialists of RUDN University Sociological Laboratory and included both original questions (projective questions, the technique of incomplete sentences), and the standard test Dayhoff S. to determine the level of internal aggressiveness. It is also used as an experiment, the technique of study option using of FACS and SPAFF to determine the psychotypes and determination of non-verbal manifestations of emotions. The study confirmed the hypothesis that in respondents’ opinion, the level of aggression is higher today than a few years ago. Differences were found in the understanding of and respect for such social phenomena as extremism, terrorism, and their danger and appeal for the two age groups of young people. Theory of psychotypes, SPAFF (specific affect cording system) and FACS (facial action cording system) are considered as additional techniques for the diagnosis of a tendency to extreme views. Thus, it is established that diagnostics of acceptance of extreme views among young people is possible thanks to simultaneous use of knowledge from the different fields of socio-humanistic sciences. The results of the research can be used in a comparative context with other countries and as a starting point for further research in the field, taking into account its extreme relevance.

The collapse of the infamous Rana Plaza, a multi-storeyed commercial building in Savar, near Dhaka, Bangladesh has brought with it a plethora of positive and negative consequences. Bangladesh being a key player in the export of clothing, found itself amidst a wave of economic upheaval following this tragic incident that resulted in numerous Bangladeshis, most of whom were factory workers. This paper compares the consequences that the country’s Ready Made Garments (RMG) sector is facing now, two years into the incident. The paper presents a comparison of statistical data from study reports and brings forward perspectives from all dimensions of Labour, Employment and Industrial Relations in Bangladesh following the event. The paper brings across the viewpoint of donor organizations and donor countries, the impacts of several initiatives taken by foreign organizations like the International Labour Organization, and local entities like the Bangladesh Garment Manufacturers and Exporters Association (BGMEA) in order to reinforce compliance and stabilize the shaky foundation that the RMG sector had found itself following the collapse. Focus of the paper remains on the stance taken by the suppliers in Bangladesh, with inputs from buying houses and factories, and also on the reaction of foreign brands. The paper also focuses on the horrific physical, mental and financial implications sustained by the victims and their families, and the consequent uproar from workers in general regarding compliance with work safety and workers’ welfare conditions. The purpose is to get across both sides of the scenario: the economic impact that suppliers / factories/ sellers/ buying houses/exporters have faced in Bangladesh as a result of complete loss of reliability on them regarding working standards; and also to cover the aftershock felt on the other end of the spectrum by the importers/ buyers, particularly the foreign entities, in terms of the sudden accountability of being affiliated with non- compliant factories. The collapse of Rana Plaza has received vast international attention and strong criticism. Nevertheless, the almost immediate strengthening of labourrights and the wholesale reform undertaken on all sides of the supply chain, evidence a move of all local and foreign stakeholders towards greater compliance and taking of precautionary steps for prevention of further disasters. The tragedy that Rana Plaza embodies served as a much-needed epiphany for the soaring RMG Sector of Bangladesh. Prompt co-operation on the part of all stakeholders and regulatory bodies now show a move towards sustainable development, which further ensures safeguarding against any future irregularities and pave the way for steady economic growth.

This paper applied factor conditions from Porter’s Diamond Model (1990) to understand the various challenges facing the AMISA. Factor conditions highlighted in Porter’s model are grouped into two groups namely, basic and advance factors. Two AMISA associations representing over 10 000 employees were interviewed. The largest Clothing, Textiles and Leather (CTL) apparel retail group was also interviewed with a government department implementing the industrialization policy were interviewed. The paper points out that AMISA have basic factor conditions necessary for competitive advantage in the apparel industries. However advance factor creation has proven to be a challenge for AMISA, Higher Education Institutions (HEIs) and government. Poor infrastructural maintenance has contributed to high manufacturing costs and poor quick response technologies. The use of Porter’s Factor Conditions as a tool to analyze the sector’s competitive advantage challenges and opportunities has increased knowledge regarding factors that limit the AMISA’s competitiveness. It is therefore argued that other studies on Porter’s Diamond model factors like Demand conditions, Firm strategy, structure and rivalry and Related and supporting industries can be used to analyze the situation of the AMISA for the purposes of improving competitive advantage.

Doxorubicin (DOX) is an anthracycline drug used to treat many cancer diseases. Similarly to other cytostatic drugs, DOX has serious side effects; the biggest obstacle is the cardiotoxicity. With the aim of lowering the negative side effects and to target the DOX into the tumor tissue, the different nanoparticles (NPs) are studied. The aim of this work was to synthetized different NPs and conjugated them with DOX and determine the binding capacity of the NPs. For this experiment, carbon nanotubes (CNTs), graphene oxide (GO), fullerene (FUL) and liposomes (LIP) were used. The highest binding capacity was observed in GO (85%). Subsequently the toxicity of NPs and NPs-DOX conjugates was analyzed in in vivo system (chicken embryos). Some NPs (GO) can increase the toxicity of DOX, whereas other NPs (LIP, CNTs) decrease DOX toxicity.

In regards to the energy sector in the modern period, two points were raised. First is a vast and growing energy demand, and second is an environmental impact associated with it. The enormous consumption of fossil fuel to the mobile unit is leading to its rapid depletion. Nuclear power is not the only problem. A modal shift that utilizes personal transporters and independent power, in order to realize a sustainable society, is very effective. The author proposes that the world will continue to work on this. Energy of the future society, innovation in battery technology and the use of natural energy is a big key. And it is also necessary in order to save on energy consumption.

The article presents the trends in Georgian wine market development and evaluates the competitive advantages of Georgia to enter the wine market based on its customs, traditions and historical practices combined with modern technologies. In order to analyze the supply of wine, dynamics of vineyard land area and grape varieties are discussed, trends in wine production are presented, trends in export and import are evaluated, local wine market, its micro and macro environments are studied and analyzed based on the interviews with experts and analysis of initial recording materials. For strengthening its position on the international market, the level of competitiveness of Georgian wine is defined, which is evaluated by “ex-ante” and “ex-post” methods, as well as by four basic and two additional factors of the Porter’s diamond method; potential advantages and disadvantages of Georgian wine are revealed. Conclusions are made by identifying the factors that hinder the development of Georgian wine market. Based on the conclusions, relevant recommendations are developed.

The purpose of this study was primarily assessing how important economic factors namely: The Thai export price of white rice, the exchange rate, and the world rice consumption affect the overall Thai white rice export, using historical data during the period 1989-2013 from the Thai Rice Exporters Association, and Food and Agricultural Organization of the United Nations. The co-integration method, regression analysis, and error correction model were applied to investigate the econometric model. The findings indicated that in the long-run, the world rice consumption, the exchange rate, and the Thai export price of white rice were the important factors affecting the export quantity of Thai white rice respectively, as indicated by their significant coefficients. Meanwhile, the rice export price was an important factor affecting the export quantity of Thai white rice in the short-run. This information is useful in the business, export opportunities, price competitiveness, and policymaker in Thailand.

This study has investigated the antidiabetic and antioxidant potential of Pseudovaria macrophylla bark extract on streptozotocin–nicotinamide induced type 2 diabetic rats. LCMSQTOF and NMR experiments were done to determine the chemical composition in the methanolic bark extract. For in vivo experiments, the STZ (60 mg/kg/b.w, 15 min after 120 mg/kg/1 nicotinamide, i.p.) induced diabetic rats were treated with methanolic extract of Pseuduvaria macrophylla (200 and 400 mg/kg·bw) and glibenclamide (2.5 mg/kg) as positive control respectively. Biochemical parameters were assayed in the blood samples of all groups of rats. The pro-inflammatory cytokines, antioxidant status and plasma transforming growth factor βeta-1 (TGF-β1) were evaluated. The histological study of the pancreas was examined and its expression level of insulin was observed by immunohistochemistry. In addition, the expression of glucose transporters (GLUT 1, 2 and 4) were assessed in pancreas tissue by western blot analysis. The outcomes of the study displayed that the bark methanol extract of Pseuduvaria macrophylla has potentially normalized the elevated blood glucose levels and improved serum insulin and C-peptide levels with significant increase in the antioxidant enzyme, reduced glutathione (GSH) and decrease in the level of lipid peroxidation (LPO). Additionally, the extract has markedly decreased the levels of serum pro-inflammatory cytokines and transforming growth factor beta-1 (TGF-β1). Histopathology analysis demonstrated that Pseuduvaria macrophylla has the potential to protect the pancreas of diabetic rats against peroxidation damage by downregulating oxidative stress and elevated hyperglycaemia. Furthermore, the expression of insulin protein, GLUT-1, GLUT-2 and GLUT-4 in pancreatic cells was enhanced. The findings of this study support the anti-diabetic claims of Pseudovaria macrophylla bark.

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

This research aims to critical analyze the feminine violent within Thai daily newspaper. This study was qualitative base; content analysis from two popular newspapers (Thairath and Dailynews) two qualitative newspapers (Thaipost and Mathichon). Purposive sampling was used to select eleven specialize news reporters to do in-depth interview. The result found that, popular newspapers, Thairath and dailynews have presented feminine violent news in their paper more than Thaipost and Mathichon the qualitative newspaper. Beside, majority of sample present the feminine violent within news under the code of ethic, The National Press Council of Thailand. Interesting, the age of feminine violent victim was the information that has been focused most. The popular newspaper have illustrated crime scene photo on their first-page while qualitative newspaper used only headline to present the same news.

This study defines a methodology to compute unitary costs for freight transportation modes. The main objective was to gather relevant costs data to support the formulation and evaluation of railway, road, pipelines and port projects. This article will concentrate on the following steps: Compilation and analysis of relevant modal cost studies, Methodological adjustments to make cost figures comparable between studies, Definition of typology and scope of transportation modes, Analysis and validation of cost values for relevant freight transportation modes in Chile. In order to define the comparison methodology for the costs between the different transportation modes, it was necessary to consider that the relevant cost depends on who performs the comparison. Thus, for the transportation user (e.g. exporter) the pertinent costs are the mode tariffs, whereas from the operators perspective (e.g. rail manager), the pertinent costs are the operating costs of each mode.

The banking sector poses a lot of problems in Nigeria in general and the non-oil export sector in particular. The banks' lack effectiveness in handling small, medium or long-term credit risk (lack of training of loan officers, lack of information on borrowers and absence of a reliable credit registry) results in non-oil exporters being burdened with high requirements, such as up to three years of financial statements, enough collateral to cover both the loan principal and interest (including a cash deposit that may be up to 30% of the loans' net present value), and to provide every detail of the international trade transaction in question. The stated problems triggered this research. Consequently, information on bank financing of non-oil exports was collected from 100 respondents from the 20 Deposit Money Banks (DMBs) in Nigeria. The data was analysed by the use of descriptive statistics correlation and regression. It is found that, Nigerian banks are participants in the financing of non-oil exports. Despite their participation, the rate of interest for credit extended to non-oil export is usually high, ranging between 15-20%. Small and medium sized non-oil export businesses lack the credit history for banks to judge them as reputable. Banks also consider the non-oil export sector very risky for investment. The banks actually do grant less credit than the exporters may require and therefore are not properly funded by banks. Banks grant very low volume of foreign currency loan in addition to, unfavorable exchange rate at which Naira is exchanged to the Dollar and other currencies in the country. This makes importation of inputs costly and negatively impacted on the non-oil export performance in Nigeria.

Constructed and natural wetlands are being used extensively to treat different types of wastewater including the domestic one. Considerable removal efficiency has been achieved for a variety of pollutants like BOD, nitrogen and phosphorous in the wetlands. Wetland treatment appears to be the best choice for treatment or pre-treatment of wastewater because of the low maintenance cost and simplicity of operation. Wetlands are the natural exporters of organic carbon on account of decomposition of organic matter. The emergent plants like reeds, bulrushes and cattails are commonly used in constructed wetland for the treatment process providing surface for bacterial growth, filtration of solids, nutrient uptake and oxygenation to promote nitrification as well as denitrification. The present paper explored different scopes of organic matter (BOD), nitrogen and phosphorous removal from wastewater through wetlands. Emphasis is given to look into the soil chemistry for tracing the behavior of carbon, nitrogen and phosphorus in the wetland. Due consideration is also made to see the viability for upgrading the BOD, nitrogen and phosphorus removal efficiency through different classical modifications of wetland.

Heat-inducible gene expression vectors are useful for hyperthermia-induced cancer gene therapy, because the combination of hyperthermia and gene therapy can considerably improve the therapeutic effects. In the present study, we developed an enhanced heat-inducible transgene expression system in which a heat-shock protein (HSP) promoter and tetracycline-responsive transactivator were combined. When the transactivator plasmid containing the tetracycline-responsive transactivator gene was co-transfected with the reporter gene expression plasmid, a high level of heat-induced gene expression was observed compared with that using the HSP promoter without the transactivator. In vitro evaluation of the therapeutic effect using HeLa cells showed that heat-induced therapeutic gene expression caused cell death in a high percentage of these cells, indicating that this strategy is promising for cancer gene therapy.

The objectives of this research were 1) to study the opinions of newspaper journalists about their trustworthiness in the National Press Council of Thailand (NPCT) and the NPCT-s success in regulating the professional ethics; and 2) to study the differences among mean vectors of the variables of trustworthiness in the NPCT and opinions on the NPCT-s success in regulating professional ethics among samples working at different work positions and from different affiliation of newspaper organizations. The results showed that 1) Interaction effects between the variables of work positions and affiliation were not statistically significant at the confidence level of 0.05. 2) There was a statistically significant difference (p

Supply Chain Management (SCM) is the integration between manufacturer, transporter and customer in order to form one seamless chain that allows smooth flow of raw materials, information and products throughout the entire network that help in minimizing all related efforts and costs. The main objective of this paper is to develop a model that can accept a specified number of spare-parts within the supply chain, simulating its inventory operations throughout all stages in order to minimize the inventory holding costs, base-stock, safety-stock, and to find the optimum quantity of inventory levels, thereby suggesting a way forward to adapt some factors of Just-In-Time to minimizing the inventory costs throughout the entire supply chain. The model has been developed using Micro- Soft Excel & Visual Basic in order to study inventory allocations in any network of the supply chain. The application and reproducibility of this model were tested by comparing the actual system that was implemented in the case study with the results of the developed model. The findings showed that the total inventory costs of the developed model are about 50% less than the actual costs of the inventory items within the case study.

This paper discusses the design characteristics management accounting systems should have to be useful for strategic planning and control and provides brief introductions to strategic variance analysis, profit-linked performance measurement models and balanced scorecard. It shows two multi-period, multiproduct models are specified, can be related to Porter's strategy framework and cost and revenue drivers, and can be used to support strategic planning, control and cost management.

This paper examines predictability in stock return in developed and emergingmarkets by testing long memory in stock returns using wavelet approach. Wavelet-based maximum likelihood estimator of the fractional integration estimator is superior to the conventional Hurst exponent and Geweke and Porter-Hudak estimator in terms of asymptotic properties and mean squared error. We use 4-year moving windows to estimate the fractional integration parameter. Evidence suggests that stock return may not be predictable indeveloped countries of the Asia-Pacificregion. However, predictability of stock return insome developing countries in this region such as Indonesia, Malaysia and Philippines may not be ruled out. Stock return in the Thailand stock market appears to be not predictable after the political crisis in 2008.

Thailand is one of the world-s leaders of rice producers and exporters. Farmers have to increase the rice cultivation frequency for serving the national increasing of export-s demand. It leads to an elimination of rice residues by open burning which is the quickest and costless management method. The open burning of rice residue is one of the major causes of air pollutants and greenhouse gas (GHG) emission. Under ASEAN agreement on trans-boundary haze, Thailand set the master plan to mitigate air pollutant emission from open burning of agricultural residues. In this master plan, residues incorporation is promoted as alternative management method to open burning. However, the assessment of both options in term of GHG emission in order to investigate their contribution to long-term global warming is still scarce or inexistent. In this study, a method on rice residues assessment was first developed in order to estimate and compare GHG emissions from rice cultivation under rice residues open burning and the case with incorporation of the same amount of rice residues, using 2006 IPCC guidelines for emission estimation and Life Cycle Analysis technique. The emission from rice cultivation in different preparing area practice was also discussed.

Due to the recovering global economy, enterprises are increasingly focusing on logistics. Investing in logistic measures for a production generates a large potential for achieving a good starting point within a competitive field. Unlike during the global economic crisis, enterprises are now challenged with investing available capital to maximize profits. In order to be able to create an informed and quantifiably comprehensible basis for a decision, enterprises need an adequate model for logistically and monetarily evaluating measures in production. The Collaborate Research Centre 489 (SFB 489) at the Institute for Production Systems (IFA) developed a Logistic Information System which provides support in making decisions and is designed specifically for the forging industry. The aim of a project that has been applied for is to now transfer this process in order to develop a universal approach to logistically and monetarily evaluate measures in production.