International Science Index

5
9998745
RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars
Abstract:

In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

Paper Detail
2327
downloads
4
9998938
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa
Abstract:

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Paper Detail
1992
downloads
3
1286
Genetic Polymorphism of the Acute Lymphoblastic Leukaemia and Hyperhomocysteinemia its Relation with the for a Group of Children in the East of Algeria
Abstract:
A lot of recent research have spoken on the relation between the increase of the homocysteinemia and some kinds of cancer . For that, our study was based on the research of a possible relation between the increase of the concentration of this amino-acid in the plasma and the appearance of the disease of the Acute Lymphoblastic Leukaemia in a part of Algerian children with Berber origin in the East of Algeria . The study has done on 47 ill persons with an average age of (09±06 ) years , with whom the disease has diagnosed by blood and marrow examination in the hospital of blood diseases in the CHU of Batna, and on 194 healthy witnesses of the same age. The two groups were benefited by a dosage of the concentration of the homocysteine vitamin B9 ,vitamin B12 , and also of the study of special polymorphisms of indispensable enzymes in the metabolism of this acid , and that by the use of the method ( Light cycler ) Real time PCR , on the following enzymes : MS ( C2756G ), MSR ( A66G ) ,MTHFR1 ( C677T ) and MTHFR2 (A1298C). The obtained results have revealed that the rate of the homozygote muted genotype is the less frequent in the two groups , and that exist at list one genotype of each enzyme in the ill group and in which the percentage exceed with remarkable way the same genotype in the healthy group and we notice specially the muted genotype GG of -the methionine synthetase-and the form TT of the enzyme – methyline tetra hydrofolate reductase – We notice the existence of considerable number of genotypes in the ill group lied with characteristic increase of this Amino-acid ,and that for the reduction of the biologic activity of these enzymes which become inefficient in the transfer of the homocysteine into the methionine and cause the diminution of the biologic activity of these enzymes and with consequence the reduction of the percentage of methylic radicals in the DNA of studied genes and that lead to the increase of the activity and the capacity of transcription , and it-s so probably that this last one is one of the factors of this disease especially if we know that the specific check-up of vitamins is normal and similar in the two groups , which ovoid the hypothesis of the reduction of vitamins . We notice also that the heterozygote genotype is the less in the sick category except the MTHFR2. Wild genotype is more frequent in the witness group except MSR. Even these results are partials; they open a new way in the genetic diagnosis of this malicious disease which allow a precocious diagnosis and the use of an effective and appropriated treatment in the same time.
Paper Detail
1779
downloads
2
4639
Genetic Polymorphism of Main Lactoproteins of Romanian Grey Steppe Breed in Preservation
Abstract:
The paper presents a part of the results obtained in a complex research project on Romanian Grey Steppe breed, owner of some remarkable qualities such as hardiness, longevity, adaptability, special resistance to ban weather and diseases and included in the genetic fund (G.D. no. 822/2008.) from Romania. Following the researches effectuated, we identified alleles of six loci, codifying the six types of major milk proteins: alpha-casein S1 (α S1-cz); beta-casein (β-cz); kappa-casein (K-cz); beta-lactoglobulin (β-lg); alpha-lactalbumin (α-la) and alpha-casein S2 (α S2-cz). In system αS1-cz allele αs1-Cn B has the highest frequency (0.700), in system β-cz allele β-Cn A2 ( 0.550 ), in system K-cz allele k-CnA2 ( 0.583 ) and heterozygote genotype AB ( 0.416 ) and BB (0.375), in system β-lg allele β-lgA1 has the highest frequency (0.542 ) and heterozygote genotype AB ( 0.500 ), in system α-la there is monomorphism for allele α-la B and similarly in system αS2-cz for allele αs2-Cn A. The milk analysis by the isoelectric focalization technique (I.E.F.) allowed the identification of a new allele for locus αS1-casein, for two of the individuals under analysis, namely allele called αS1-casein IRV. When experiments were repeated, we noticed that this is not a proteolysis band and it really was a new allele that has not been registered in the specialized literature so far. We identified two heterozygote individuals, carriers of this allele, namely: BIRV and CIRV. This discovery is extremely important if focus is laid on the national genetic patrimony.
Paper Detail
1375
downloads
1
24
Quantitative Genetics Researches on Milk Protein Systems of Romanian Grey Steppe Breed
Abstract:
The paper makes part from a complex research project on Romanian Grey Steppe, a unique breed in terms of biological and cultural-historical importance, on the verge of extinction and which has been included in a preservation programme of genetic resources from Romania. The study of genetic polymorphism of protean fractions, especially kappa-casein, and the genotype relations of these lactoproteins with some quantitative and qualitative features of milk yield represents a current theme and a novelty for this breed. In the estimation of the genetic parameters we used R.E.M.L. (Restricted Maximum Likelihood) method. The main lactoprotein from milk, kappa - casein (K-cz), characterized in the specialized literature as a feature having a high degree of hereditary transmission, behaves as such in the nucleus under study, a value also confirmed by the heritability coefficient (h2 = 0.57 %). We must mention the medium values for milk and fat quantity (h2=0.26, 0.29 %) and the fat and protein percentage from milk having a high hereditary influence h2 = 0.71 - 0.63 %. Correlations between kappa-casein and the milk quantity are negative and strong. Between kappa-casein and other qualitative features of milk (fat content 0.58-0.67 % and protein content 0.77- 0.87%), there are positive and very strong correlations. At the same time, between kappa-casein and β casein (β-cz), β lactoglobulin (β- lg) respectively, correlations are positive having high values (0.37 – 0.45 %), indicating the same causes and determining factors for the two groups of features.
Paper Detail
1387
downloads